The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1300
Genome IDAE009439
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanopyrus kandleri AV19 [AE009439]
Start position on genome 584970
End posion on genome 585046
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gcacaggcgc
tRNA gene sequence
GGGCCCGCAGTTCAGCCCGGCAGAACGCCGGCCTTACGAGCCGGTGGTCCCGGGTTCAAA
TCCCGGCGGGCCCACCA
Downstream region at tRNA end position
ccactaattg
Secondary structure (Cloverleaf model)
>At1300	Val	TAC
                   c      ACCA ccactaattg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    C     G G C C C     A
      C G A        A      | | | | |     A
    C       C T T G       C C G G G     C
    C       | | | |                 T T
    G       G A A C
      G C A        G     TGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGCAGTTCAGCCCGGCAGAACGCCGGCCTTACGAGCCGGTGGTCCCGGGTTCAAA
TCCCGGCGGGCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK