The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1302
Genome IDAE009439
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanopyrus kandleri AV19 [AE009439]
Start position on genome 720653
End posion on genome 720730
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ggttcgggtc
tRNA gene sequence
GGGCCGGCAGCTCAGTCTGGCTAGAGCGCGGGACTTTTAATCCCGTGGTCCCGGGTTCAA
ATCCCGGCCGGCCCACCA
Downstream region at tRNA end position
aaatgctcaa
Secondary structure (Cloverleaf model)
>At1302	Lys	TTT
                   c      ACCA aaatgctcaa
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    C     G G C C C     A
    C T G A        A      | | | | |     A
  T         C T C G       C C G G G     C
  G         | | | |                 T T
  G         G A G C
    C T A          G     TGGTC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGCAGCTCAGTCTGGCTAGAGCGCGGGACTTTTAATCCCGTGGTCCCGGGTTCAA
ATCCCGGCCGGCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK