The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1327
Genome IDCP000477
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothrix thermoacetophila PT [CP000477]
Start position on genome 23457
End posion on genome 23544
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
atgctcatgg
tRNA gene sequence
GGGCTCGTAGCTCAGTTAGGCAGAGCGCCTGGCTTTTAACCAGGTGGCCGAGGGTTCAAA
TCCCCCCGAGCCCGtat
Downstream region at tRNA end position
gtagcttttc
Secondary structure (Cloverleaf model)
>At1327	Lys	TTT
                   g      Gtat gtagcttttc
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C C C C C     A
      T G A        A      |   | | |     A
    T       C T C G       G A G G G     C
    A       | | | |                 T T
    G       G A G C
      G C A        G     TGGCC
                    C - G
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A *
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGCTCAGTTAGGCAGAGCGCCTGGCTTTTAaattttatgaagacACCAGGTG
GCCGAGGGTTCAAATCCCCCCGAGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK