The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1355
Genome IDCP000477
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothrix thermoacetophila PT [CP000477]
Start position on genome 308504
End posion on genome 308431
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
ggtggcggta
tRNA gene sequence
GGGCCCGTGGTCTAGGTGGTCATGACATCGCCCTTACACGGCGGGGATCACGCGTTCGAA
TCGCGTCGGGCCCAtcg
Downstream region at tRNA end position
tcacaatcat
Secondary structure (Cloverleaf model)
>At1355	Val	TAC
                   a      Atcg tcacaatcat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T G C G C     A
      G G A        G      | | | | |     G
    T       T C T G       A C G C G     C
    G         | | |                 T T
    G       T G A C
      T C A        A     GGATC
                    T + G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGTCTAGGTGGTCATGACATCGCCCTTACACGGCGGGGATCACGCGTTCGAA
TCGCGTCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK