The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1358
Genome IDCP000477
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothrix thermoacetophila PT [CP000477]
Start position on genome 551741
End posion on genome 551669
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
cttgagaatt
tRNA gene sequence
GTCCGGATGGTGTAGAGGCCTATCATGAAGCCCTGTCGAGGCTTCGACCCGGGTTCGAAT
CCCGGTCCGGGCGctt
Downstream region at tRNA end position
atttttcctg
Secondary structure (Cloverleaf model)
>At1358	Asp	GTC
                   t      Gctt atttttcctg
                     G - C
                     T + G
                     C - G
                     C - G
                     G - C
                     G - C
                     A - T          T A
                    T     G G C C C     A
      A G A        G      | | | | |     G
    G       T G T G       C C G G G     C
    G         | | +                 T T
    C       T C A T
      C T A        G     CGAC
                    A - T
                    A - T
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GTCCGGATGGTGTAGAGGCCTATCATGAAGCCCTGTCGAGGCTTCGACCCGGGTTCGAAT
CCCGGTCCGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK