The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1362
Genome IDCP000477
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothrix thermoacetophila PT [CP000477]
Start position on genome 905696
End posion on genome 905624
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
ccaaatttgt
tRNA gene sequence
GGGCACGTAGATCAGCTGGAAGATCGCTACCTTCGCAAGGTAGAGGCCGCGGGTCCGAAT
CCCGCCGTGTCCAttc
Downstream region at tRNA end position
gacggtttta
Secondary structure (Cloverleaf model)
>At1362	Ala	CGC
                   t      Attc gacggtttta
                     G - C
                     G - C
                     G + T
                     C - G
                     A - T
                     C - G
                     G - C          T A
                    T     C G C C C     A
      C G A        A      | | | | |     G
    T       C T A G       G C G G G     C
    G       | | | |                 T C
    G       G A T C
      A A          G     AGGCC
                    C - G
                    T - A
                    A - T
                    C - G
                    C - G
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCACGTAGATCAGCTGGAAGATCGCTACCTTCGCAAGGTAGAGGCCGCGGGTCCGAAT
CCCGCCGTGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK