The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1368
Genome IDCP000477
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothrix thermoacetophila PT [CP000477]
Start position on genome 1457298
End posion on genome 1457224
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gaaaccgaat
tRNA gene sequence
GGACCCGTGGCTTAGCCAGGATATAGCACCGGGCTTCTAACCCGGGGGTCGCGGGTTCGA
GTCCCGCCGGGTCCGtca
Downstream region at tRNA end position
tatccattgg
Secondary structure (Cloverleaf model)
>At1368	Arg	TCT
                   t      Gtca tatccattgg
                     G - C
                     G - C
                     A - T
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     C G C C C     A
    C C G A        G      | | | | |     G
  A         T T C G       G C G G G     C
  G           | | |                 T T
  G         T A G C
    A T A          A     GGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGACCCGTGGCTTAGCCAGGATATAGCACCGGGCTTCTAACCCGGGGGTCGCGGGTTCGA
GTCCCGCCGGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK