The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1404
Genome IDAE010299
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina acetivorans C2A [AE010299]
Start position on genome 259768
End posion on genome 259696
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
agaccgaagt
tRNA gene sequence
GTCCGGATAGTGTAGAGGCCTATCATGGAGCCCTGTCGAGGCTCCGACTCGGGTTCGAAT
CCCGGTCCGGGCGctt
Downstream region at tRNA end position
ctttttttcg
Secondary structure (Cloverleaf model)
>At1404	Asp	GTC
                   t      Gctt ctttttttcg
                     G - C
                     T + G
                     C - G
                     C - G
                     G - C
                     G - C
                     A - T          T A
                    T     G G C C C     A
      A G A        A      + | | | |     G
    G       T G T G       T C G G G     C
    G         | | +                 T T
    C       T C A T
      C T A        G     CGAC
                    G - C
                    A - T
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GTCCGGATAGTGTAGAGGCCTATCATGGAGCCCTGTCGAGGCTCCGACTCGGGTTCGAAT
CCCGGTCCGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK