The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1411
Genome IDAE010299
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina acetivorans C2A [AE010299]
Start position on genome 754369
End posion on genome 754290
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
atcacaaaat
tRNA gene sequence
GCCCAGGTCGTCTAGTGGTATGGCGACGGTCTCGAAAACCGTTCCCTTTGGGATCGCAGG
TTCAAATCCTGCCCTGGGCGtga
Downstream region at tRNA end position
ctctcaatct
Secondary structure (Cloverleaf model)
>At1411	Ser	CGA
                   t      Gtga ctctcaatct
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     G - C
                     G - C          T A
                    T     C G T C C     A
        G A        C      | | | | |     A
      T     T C T G       G C A G G     C
      G       | + |                 T T
      G     T G G C
        T A        G     TCCCTTTGGGATC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCAGGTCGTCTAGTGGTATGGCGACGGTCTCGAAAACCGTTCCCTTTGGGATCGCAGG
TTCAAATCCTGCCCTGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK