The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1413
Genome IDAE010299
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina acetivorans C2A [AE010299]
Start position on genome 1509797
End posion on genome 1509721
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
taaacaaacc
tRNA gene sequence
GGGCCCGTAGCTCAGTCAGGCAGAGCGACTGGCTTTTAACCAGTCGGCCTAGGGTTCAAA
TCCCTACGGGCCCGCCA
Downstream region at tRNA end position
tgttcttatt
Secondary structure (Cloverleaf model)
>At1413	Lys	TTT
                   c      GCCA tgttcttatt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     A T C C C     A
      T G A        A      | | | | |     A
    C       C T C G       T A G G G     C
    A       | | | |                 T T
    G       G A G C
      G C A        G     CGGCC
                    A - T
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGTCAGGCAGAGCGACTGGCTTTTAACCAGTCGGCCTAGGGTTCAAA
TCCCTACGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK