The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1424
Genome IDAE010299
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina acetivorans C2A [AE010299]
Start position on genome 4715951
End posion on genome 4715877
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gggcacgtgt
tRNA gene sequence
AGCCCTGTAGTGTAGCCAGGCCAATCACTCTTGACTTTGGATCAAGAAACCCCGGTTCAA
ATCCGGGCAGGGCAAcgg
Downstream region at tRNA end position
ggttaataca
Secondary structure (Cloverleaf model)
>At1424	Gln	TTG
                   t      Acgg ggttaataca
                     A   A
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     G G G C C     A
    C C G A        A      | | | | |     A
  A         T G T G       C C C G G     C
  G           | | |                 T T
  G         T C A C
    C C A A        T     AAAC
                    C - G
                    T - A
                    T - A
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCTGTAGTGTAGCCAGGCCAATCACTCTTGACTTTGGATCAAGAAACCCCGGTTCAA
ATCCGGGCAGGGCAA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK