The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1429
Genome IDAE010299
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina acetivorans C2A [AE010299]
Start position on genome 5354680
End posion on genome 5354606
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
taagcaacca
tRNA gene sequence
GGGCTCGTGGCTTAGCCAGGATATAGCGCTGGGCTTCTAACCCAGACGTCGGGGGTTCAA
ATCCCTTCGAGCCCGctt
Downstream region at tRNA end position
tattcctctt
Secondary structure (Cloverleaf model)
>At1429	Arg	TCT
                   a      Gctt tattcctctt
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     T T C C C     A
    C C G A        G      + + | | |     A
  A         T T C G       G G G G G     C
  G           | | |                 T T
  G         T A G C
    A T A          G     ACGTC
                    C - G
                    T - A
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTGGCTTAGCCAGGATATAGCGCTGGGCTTCTAACCCAGACGTCGGGGGTTCAA
ATCCCTTCGAGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK