The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1436
Genome IDCP000099
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina barkeri [CP000099]
Start position on genome 693337
End posion on genome 693411
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
aaagcaaaca
tRNA gene sequence
GGGCTCGTGGCTTAGCCAGGATATAGCGCTGGGCTTCTAACCCAGACGTCGGGGGTTCAA
ATCCCTTCGAGCCCGctt
Downstream region at tRNA end position
aatcatttat
Secondary structure (Cloverleaf model)
>At1436	Arg	TCT
                   a      Gctt aatcatttat
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     T T C C C     A
    C C G A        G      + + | | |     A
  A         T T C G       G G G G G     C
  G           | | |                 T T
  G         T A G C
    A T A          G     ACGTC
                    C - G
                    T - A
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTGGCTTAGCCAGGATATAGCGCTGGGCTTCTAACCCAGACGTCGGGGGTTCAA
ATCCCTTCGAGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK