The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1441
Genome IDCP000099
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina barkeri [CP000099]
Start position on genome 1516507
End posion on genome 1516579
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
tttaacatgc
tRNA gene sequence
AGTCCTGTAGGGTAGTGGTCAATCCTTCGGGCCTTTGGAGCCCGGGACAGCGGTTCGAAT
CCGCTCAGGACTAtta
Downstream region at tRNA end position
tttaatttta
Secondary structure (Cloverleaf model)
>At1441	Gln	TTG
                   c      Atta tttaatttta
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     T C G C C     A
      T G A        A      | | | | |     G
    G       T G G G       A G C G G     C
    G         | | +                 T T
    T       T C C T
      C A A        T     GGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGTCCTGTAGGGTAGTGGTCAATCCTTCGGGCCTTTGGAGCCCGGGACAGCGGTTCGAAT
CCGCTCAGGACTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK