The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1448
Genome IDCP000099
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina barkeri [CP000099]
Start position on genome 2625515
End posion on genome 2625588
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
tcggcaaact
tRNA gene sequence
GGGCTCGTGGTCTAGTCGGTTATGACATCGCCTTTACACGGCGGGGATCCTGAGTTCGAA
TCTCAGCGGGCCCActc
Downstream region at tRNA end position
tttttattat
Secondary structure (Cloverleaf model)
>At1448	Val	TAC
                   t      Actc tttttattat
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     G - C          T A
                    T     G A C T C     A
      T G A        G      | | | | |     G
    C       T C T G       C T G A G     C
    G         | | |                 T T
    G       T G A C
      T T A        A     GGATC
                    T + G
                    C - G
                    G - C
                    C - G
                    C - G
                  T       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTGGTCTAGTCGGTTATGACATCGCCTTTACACGGCGGGGATCCTGAGTTCGAA
TCTCAGCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK