The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1457
Genome IDCP000099
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina barkeri [CP000099]
Start position on genome 4407895
End posion on genome 4407966
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
ttcttcaaaa
tRNA gene sequence
GGGCTCGTAGATCAGGGGAAGATCGTTACGTTCGCAACGTAAAGGCCGCGGGTTCAAATC
CCGCCGAGTCCAtta
Downstream region at tRNA end position
aaaactttta
Secondary structure (Cloverleaf model)
>At1457	Ala	CGC
                   a      Atta aaaactttta
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C G C C C     A
        G A        A      | | | | |     A
      G     C T A G       G C G G G     C
      G     | | | |                 T T
      G     G A T C
        A A        G     AGGCC
                    T - A
                    T - A
                    A - T
                    C - G
                    G - C
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGATCAGGGGAAGATCGTTACGTTCGCAACGTAAAGGCCGCGGGTTCAAATC
CCGCCGAGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK