The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1495
Genome IDCP000099
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina barkeri [CP000099]
Start position on genome 4759576
End posion on genome 4759500
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
aaaagcaact
tRNA gene sequence
GGGCCCGTAGCTCAGTCAGGCAGAGCGTCTGGCTTTTAACCAGACGGCCTAGGGTTCAAA
TCCCTACGGGCCCGCCA
Downstream region at tRNA end position
tattcttaat
Secondary structure (Cloverleaf model)
>At1495	Lys	TTT
                   t      GCCA tattcttaat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     A T C C C     A
      T G A        A      | | | | |     A
    C       C T C G       T A G G G     C
    A       | | | |                 T T
    G       G A G C
      G C A        G     CGGCC
                    T - A
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGTCAGGCAGAGCGTCTGGCTTTTAACCAGACGGCCTAGGGTTCAAA
TCCCTACGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK