The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1524
Genome IDAE008384
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina mazei Go1 [AE008384]
Start position on genome 2997633
End posion on genome 2997704
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
tttcgtaaaa
tRNA gene sequence
GGGCTCGTAGATCAGGGGAAGATCGTTACGTTCGCAACGTAAAGGCCGCGGGTTCAAATC
CCGCCGAGTCCActa
Downstream region at tRNA end position
acaaatttat
Secondary structure (Cloverleaf model)
>At1524	Ala	CGC
                   a      Acta acaaatttat
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C G C C C     A
        G A        A      | | | | |     A
      G     C T A G       G C G G G     C
      G     | | | |                 T T
      G     G A T C
        A A        G     AGGCC
                    T - A
                    T - A
                    A - T
                    C - G
                    G - C
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGATCAGGGGAAGATCGTTACGTTCGCAACGTAAAGGCCGCGGGTTCAAATC
CCGCCGAGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK