The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1528
Genome IDAE008384
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina mazei Go1 [AE008384]
Start position on genome 335960
End posion on genome 335887
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gcagcaaact
tRNA gene sequence
GGGCTCGTGGTCTAGTCGGTTATGACATCGCCTTTACACGGCGGGGATCCTGAGTTCGAA
TCTCAGCGGGCCCActt
Downstream region at tRNA end position
ttatcatttc
Secondary structure (Cloverleaf model)
>At1528	Val	TAC
                   t      Actt ttatcatttc
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     G - C          T A
                    T     G A C T C     A
      T G A        G      | | | | |     G
    C       T C T G       C T G A G     C
    G         | | |                 T T
    G       T G A C
      T T A        A     GGATC
                    T + G
                    C - G
                    G - C
                    C - G
                    C - G
                  T       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTGGTCTAGTCGGTTATGACATCGCCTTTACACGGCGGGGATCCTGAGTTCGAA
TCTCAGCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK