The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1545
Genome IDAE008384
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina mazei Go1 [AE008384]
Start position on genome 2154810
End posion on genome 2154731
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
taatcaaaat
tRNA gene sequence
GCCCAGGTCGTCTAGCGGTATGGCGACGGTCTCGAAAACCGTTCCCCTTGGGATCGCAGG
TTCGAATCCTGCCCTGGGCGtaa
Downstream region at tRNA end position
ttttcaggat
Secondary structure (Cloverleaf model)
>At1545	Ser	CGA
                   t      Gtaa ttttcaggat
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     G - C
                     G - C          T A
                    T     C G T C C     A
        G A        C      | | | | |     G
      C     T C T G       G C A G G     C
      G       | + |                 T T
      G     T G G C
        T A        G     TCCCCTTGGGATC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCAGGTCGTCTAGCGGTATGGCGACGGTCTCGAAAACCGTTCCCCTTGGGATCGCAGG
TTCGAATCCTGCCCTGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK