The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1547
Genome IDAE008384
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina mazei Go1 [AE008384]
Start position on genome 2702960
End posion on genome 2702884
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
taaacaaact
tRNA gene sequence
GGGCCCGTAGCTCAGTCAGGCAGAGCGACTGGCTTTTAACCAGTCGGCCTAGGGTTCAAA
TCCCTACGGGCCCGCCA
Downstream region at tRNA end position
tgttctttat
Secondary structure (Cloverleaf model)
>At1547	Lys	TTT
                   t      GCCA tgttctttat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     A T C C C     A
      T G A        A      | | | | |     A
    C       C T C G       T A G G G     C
    A       | | | |                 T T
    G       G A G C
      G C A        G     CGGCC
                    A - T
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGTCAGGCAGAGCGACTGGCTTTTAACCAGTCGGCCTAGGGTTCAAA
TCCCTACGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK