The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1553
Genome IDCP000102
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosphaera stadtmanae DSM 3091 [CP000102]
Start position on genome 21020
End posion on genome 21091
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
tttatttatt
tRNA gene sequence
GGGCTGGTGGTCTAGGGGTATGATACCTCCCTTACAAGGAGGGGATCAGGAGTTCAAATC
TCCTCCGGCCCAttt
Downstream region at tRNA end position
atttaattat
Secondary structure (Cloverleaf model)
>At1553	Val	TAC
                   t      Attt atttaattat
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     G - C
                     G - C          T A
                    T     T C C T C     A
        G A        G      | | | | |     A
      G     T C T G       A G G A G     C
      G       | | +                 T T
      G     T G A T
        T A        A     GGATC
                    C - G
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTGGTGGTCTAGGGGTATGATACCTCCCTTACAAGGAGGGGATCAGGAGTTCAAATC
TCCTCCGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK