The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1583
Genome IDCP000102
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosphaera stadtmanae DSM 3091 [CP000102]
Start position on genome 1002836
End posion on genome 1002753
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
aagaacaaat
tRNA gene sequence
GCCGAGATAGTCTAGCTTGGTAAGGCGCAAGACTGGAAATCTTGTGGAGTGATCTCCTCC
TGGGTTCAAATCCCAGTCTCGGCGctt
Downstream region at tRNA end position
ataattattt
Secondary structure (Cloverleaf model)
>At1583	Ser	GGA
                   t      Gctt ataattattt
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C
                     A - T          T A
                    T     G A C C C     A
      C G A        A      | | | | |     A
    T       T C T G       C T G G G     C
    T       | | + |                 T T
    G       A G G C
      G T A        G     TGGAGTGATCTCCTC
                    C - G
                    A - T
                    A - T
                    G - C
                    A - T
                  C       A
                  T       A
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGAGATAGTCTAGCTTGGTAAGGCGCAAGACTGGAAATCTTGTGGAGTGATCTCCTCC
TGGGTTCAAATCCCAGTCTCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK