The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1587
Genome IDCP000102
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosphaera stadtmanae DSM 3091 [CP000102]
Start position on genome 1550305
End posion on genome 1550232
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
cattttatag
tRNA gene sequence
GGGCTCGTAGCTCAGTCTGGGAGAGCGCCTGGCTTTTAACCAGGCGGTCGCGGGTTCAAC
TCCCGTCGGGCCCGctt
Downstream region at tRNA end position
atattttaac
Secondary structure (Cloverleaf model)
>At1587	Lys	TTT
                   g      Gctt atattttaac
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     G - C          T C
                    T     T G C C C     A
      T G A        A      + | | | |     A
    C       C T C G       G C G G G     C
    T       | | | |                 T T
    G       G A G C
      G G A        G     CGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGCTCAGTCTGGGAGAGCGCCTGGCTTTTAACCAGGCGGTCGCGGGTTCAAC
TCCCGTCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK