The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1594
Genome IDCP000102
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosphaera stadtmanae DSM 3091 [CP000102]
Start position on genome 1703981
End posion on genome 1703907
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
attaatatat
tRNA gene sequence
GGGCCTGTAGCCTAGACTGGATAGGGCGTTGGACTTCTAATCCAAAGGCCGGGGGTTCAA
ATCCCCCCAGGTCCGcta
Downstream region at tRNA end position
tcttttatac
Secondary structure (Cloverleaf model)
>At1594	Arg	TCT
                   t      Gcta tcttttatac
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     C C C C C     A
    C A G A        A      | | | | |     A
  T         T C C G       G G G G G     C
  G         + | | |                 T T
  G         G G G C
    A T A          G     AGGCC
                    T - A
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCTGTAGCCTAGACTGGATAGGGCGTTGGACTTCTAATCCAAAGGCCGGGGGTTCAA
ATCCCCCCAGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK