The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1596
Genome IDCP000254
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanospirillum hungatei JF-1 [CP000254]
Start position on genome 66705
End posion on genome 66778
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
gtgactaacg
tRNA gene sequence
GGGTTCGTAGCTCAGTTAGGCAGAGCGCCTGGCTTTTAACCAGGTGGTCGGGGGTTCAAA
TCCCCTCGAGCCCGctc
Downstream region at tRNA end position
cacgacagtt
Secondary structure (Cloverleaf model)
>At1596	Lys	TTT
                   g      Gctc cacgacagtt
                     G - C
                     G - C
                     G - C
                     T + G
                     T - A
                     C - G
                     G - C          T A
                    T     T C C C C     A
      T G A        A      + | | | |     A
    T       C T C G       G G G G G     C
    A       | | | |                 T T
    G       G A G C
      G C A        G     TGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGTTCGTAGCTCAGTTAGGCAGAGCGCCTGGCTTTTAACCAGGTGGTCGGGGGTTCAAA
TCCCCTCGAGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK