| Sequence ID | >WENV170470235 |
| Genome ID | CEVF01201145 |
| Phylum/Class | [CEVF] marine metagenome genome assembly TARA_124_SRF_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
| Species | |
|
Start position on genome
|
470
|
|
End posion on genome
|
395
|
|
Amino Acid
|
Ala
|
|
Anticodon
|
TGC
|
|
Upstream region at tRNA start position
|
cgcaattatt
|
|
tRNA gene sequence
|
GGGGCTATAGCTCAGCTGGGAGAGCGCCTGGTTTGCATCCAGGAGGTCTGCGGTTCGATC CCGCATAGCTCCACCA
|
|
Downstream region at tRNA end position
|
acatctatcc
|
| Secondary structure (Cloverleaf model) | >WENV170470235 Ala TGC
t ACCA acatctatcc
G - C
G - C
G + T
G - C
C - G
T - A
A - T C T
T A C G C C A
C G A A | | | | | G
T C T C G T G C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
C - G
T - A
G - C
G - C
T T
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |