The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1606
Genome IDCP000254
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanospirillum hungatei JF-1 [CP000254]
Start position on genome 1365368
End posion on genome 1365440
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tgttcccaaa
tRNA gene sequence
GCCCAGATAGTGTAGTGGCCTATCATGTCGGCCTGTCACGCCGACGACTCGGATTCGAAT
TCCGATCTGGGCGttc
Downstream region at tRNA end position
attaatcaat
Secondary structure (Cloverleaf model)
>At1606	Asp	GTC
                   a      Gttc attaatcaat
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     G - C
                     A - T          T A
                    T     A G C C T     A
      T G A        A      | | | | |     G
    G       T G T G       T C G G A     C
    G         | | +                 T T
    C       T C A T
      C T A        G     CGAC
                    T - A
                    C - G
                    G - C
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCAGATAGTGTAGTGGCCTATCATGTCGGCCTGTCACGCCGACGACTCGGATTCGAAT
TCCGATCTGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK