The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1607
Genome IDCP000254
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanospirillum hungatei JF-1 [CP000254]
Start position on genome 1370685
End posion on genome 1370757
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gctcttttca
tRNA gene sequence
ACTCCCGTAGTGTAGAGGTCAATCATATCGGATTTTGGTTCCGATGACGACGGTTCGAAT
CCGTCCGGGAGTAtct
Downstream region at tRNA end position
tttttgctga
Secondary structure (Cloverleaf model)
>At1607	Gln	TTG
                   a      Atct tttttgctga
                     A - T
                     C - G
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C T G C C     A
      A G A        A      | | | | |     G
    G       T G T G       G A C G G     C
    G         | | +                 T T
    T       T C A T
      C A A        A     TGAC
                    T - A
                    C - G
                    G - C
                    G - C
                    A - T
                  T       T
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
ACTCCCGTAGTGTAGAGGTCAATCATATCGGATTTTGGTTCCGATGACGACGGTTCGAAT
CCGTCCGGGAGTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK