The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1622
Genome IDCP000254
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanospirillum hungatei JF-1 [CP000254]
Start position on genome 76803
End posion on genome 76729
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gcacatcttt
tRNA gene sequence
GGGCCTGTGGCTTAGCCAGGATATAGCGTCGGGCTTCTAACCCGAATGTCGGGGGTTCGA
ATCCCTCCAGGTCCGctc
Downstream region at tRNA end position
gtttttaaaa
Secondary structure (Cloverleaf model)
>At1622	Arg	TCT
                   t      Gctc gtttttaaaa
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     T - A
                     G - C          T A
                    T     C T C C C     A
    C C G A        G      | + | | |     G
  A         T T C G       G G G G G     C
  G           | | |                 T T
  G         T A G C
    A T A          G     ATGTC
                    T - A
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCTGTGGCTTAGCCAGGATATAGCGTCGGGCTTCTAACCCGAATGTCGGGGGTTCGA
ATCCCTCCAGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK