The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1634
Genome IDCP000254
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanospirillum hungatei JF-1 [CP000254]
Start position on genome 2753937
End posion on genome 2753866
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
tctccatttc
tRNA gene sequence
GGGCTCGTAGATCAGTGGGAGATCGCTGTGTTCGCAACGCAGAGGCCGCGGGTTCAAATC
CCGCCGGGTCCAttt
Downstream region at tRNA end position
ttttgataat
Secondary structure (Cloverleaf model)
>At1634	Ala	CGC
                   c      Attt ttttgataat
                     G - C
                     G - C
                     G + T
                     C - G
                     T + G
                     C - G
                     G - C          T A
                    T     C G C C C     A
        G A        A      | | | | |     A
      T     C T A G       G C G G G     C
      G     | | | |                 T T
      G     G A T C
        G A        G     AGGCC
                    C - G
                    T - A
                    G - C
                    T + G
                    G - C
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGATCAGTGGGAGATCGCTGTGTTCGCAACGCAGAGGCCGCGGGTTCAAATC
CCGCCGGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK