The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1646
Genome IDAE000666
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothermobacter thermautotrophicus str. Delta H [AE000666]
Start position on genome 17473
End posion on genome 17557
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
tacatcctgt
tRNA gene sequence
GCCGGGATAGCCTAGCCAGGTAAGGCGCAAGACTGGAAATCTTGTGGAGCTTTGCTCCTC
CTGGGTTCAAATCCCAGTCCCGGCGtcg
Downstream region at tRNA end position
gttaaagcaa
Secondary structure (Cloverleaf model)
>At1646	Ser	GGA
                   t      Gtcg gttaaagcaa
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     G A C C C     A
      C G A        A      | | | | |     A
    C       T C C G       C T G G G     C
    A       | | | |                 T T
    G       A G G C
      G T A        G     TGGAGCTTTGCTCCTC
                    C - G
                    A - T
                    A - T
                    G - C
                    A - T
                  C       A
                  T       A
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGATAGCCTAGCCAGGTAAGGCGCAAGACTGGAAATCTTGTGGAGCTTTGCTCCTC
CTGGGTTCAAATCCCAGTCCCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK