The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1655
Genome IDAE000666
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothermobacter thermautotrophicus str. Delta H [AE000666]
Start position on genome 863940
End posion on genome 864011
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
taactgtcat
tRNA gene sequence
AGTCCCGTGGGGTAGTGGTAATCCTGCTGGGCTTTGGACCCGGCGACAGCGGTTCGACTC
CGCTCGGGACTAtca
Downstream region at tRNA end position
aaccactgat
Secondary structure (Cloverleaf model)
>At1655	Gln	TTG
                   t      Atca aaccactgat
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T C
                    T     T C G C C     A
      T G A        G      | | | | |     G
    G       T G G G       A G C G G     C
    G         | | +                 T T
    T       T C C T
      A A          G     CGAC
                    C - G
                    T + G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGTCCCGTGGGGTAGTGGTAATCCTGCTGGGCTTTGGACCCGGCGACAGCGGTTCGACTC
CGCTCGGGACTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK