The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1659
Genome IDAE000666
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothermobacter thermautotrophicus str. Delta H [AE000666]
Start position on genome 954350
End posion on genome 954421
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
ctagagactt
tRNA gene sequence
GCCCTGGTGGTGTAGGGGCTATCATGCGGGCCTGTCGAGCCCGCGACTCGGGTTCAATTC
CCGGCCAGGGCGttt
Downstream region at tRNA end position
cctgagggcc
Secondary structure (Cloverleaf model)
>At1659	Asp	GTC
                   t      Gttt cctgagggcc
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C
                     G - C          T T
                    T     G G C C C     A
      G G A        G      + | | | |     A
    G       T G T G       T C G G G     C
    G         | | +                 T T
    C       T C A T
      T A          G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCTGGTGGTGTAGGGGCTATCATGCGGGCCTGTCGAGCCCGCGACTCGGGTTCAATTC
CCGGCCAGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK