The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1663
Genome IDAE000666
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothermobacter thermautotrophicus str. Delta H [AE000666]
Start position on genome 1181056
End posion on genome 1181130
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tcttttgtta
tRNA gene sequence
GGGCCCGTAGCCTAGCCAGGATAGGGCGTCGGACTTCTAATCCGAAGGTCCCGGGTTCAA
ATCCCGGCGGGTCCGcta
Downstream region at tRNA end position
aaaaaggtgc
Secondary structure (Cloverleaf model)
>At1663	Arg	TCT
                   a      Gcta aaaaaggtgc
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  A         T C C G       C C G G G     C
  G         + | | |                 T T
  G         G G G C
    A T A          G     AGGTC
                    T - A
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCCTAGCCAGGATAGGGCGTCGGACTTCTAATCCGAAGGTCCCGGGTTCAA
ATCCCGGCGGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK