The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1666
Genome IDAE000666
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothermobacter thermautotrophicus str. Delta H [AE000666]
Start position on genome 1295989
End posion on genome 1296060
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gtcacactga
tRNA gene sequence
GGGCCGGTGGTCTAGGGGTATGATACCTCGCTTACAACGAGGTGGTCACGAGTTCGAATC
TCGTCCGGCCCAttt
Downstream region at tRNA end position
attattcttc
Secondary structure (Cloverleaf model)
>At1666	Val	TAC
                   a      Attt attattcttc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     T G C T C     A
        G A        G      | | | | |     G
      G     T C T G       A C G A G     C
      G       | | +                 T T
      G     T G A T
        T A        A     TGGTC
                    C - G
                    C - G
                    T - A
                    C - G
                    G - C
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTGGTCTAGGGGTATGATACCTCGCTTACAACGAGGTGGTCACGAGTTCGAATC
TCGTCCGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK