The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1675
Genome IDAE000666
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanothermobacter thermautotrophicus str. Delta H [AE000666]
Start position on genome 1159072
End posion on genome 1158931
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
ttatctgcat
tRNA gene sequence
GGGGTCATGGTGTAACCAGGCTATCATCTGGGACTCCAGATCCTAGGATCTGGGTTCAAA
TCCCAGTGACCCCAttc
Downstream region at tRNA end position
aacccccctt
Secondary structure (Cloverleaf model)
>At1675	Trp	CCA
                   t      Attc aacccccctt
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     A - T          T A
                    T     G A C C C     A
    C C A A        G      | | | | |     A
  A         T G T G       C T G G G     C
  G           | | +                 T T
  G         T C A T
    C T A          C     GGAT
                    T - A
                    G + T
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGTCATGGTGTAACCAGGCTATCATCTGGGACTCCAGttgtctttgaagaaaatgcgc
gctctgactacagtatgatgaccaattggagtactgagacaagagaaATCCTAGGATCTG
GGTTCAAATCCCAGTGACCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK