The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1685
Genome IDCR936257
Search identical group
Phylum/ClassEuryarchaeota
SpeciesNatronomonas pharaonis DSM 2160 Gabara [CR936257]
Start position on genome 157388
End posion on genome 157459
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
cgattgatgc
tRNA gene sequence
GGGCTCGTAGATCAGCGGCAGATCGCTTCCTTCGCAAGGAAGAGGCCCCGGGTTCAAATC
CCGGCGAGTCCActa
Downstream region at tRNA end position
ttttgcgccg
Secondary structure (Cloverleaf model)
>At1685	Ala	CGC
                   c      Acta ttttgcgccg
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     G G C C C     A
        G A        A      | | | | |     A
      C     C T A G       C C G G G     C
      G     | | | |                 T T
      G     G A T C
        C A        G     AGGCC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGATCAGCGGCAGATCGCTTCCTTCGCAAGGAAGAGGCCCCGGGTTCAAATC
CCGGCGAGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK