The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1691
Genome IDCR936257
Search identical group
Phylum/ClassEuryarchaeota
SpeciesNatronomonas pharaonis DSM 2160 Gabara [CR936257]
Start position on genome 560890
End posion on genome 560963
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
cacttggtgt
tRNA gene sequence
GGGCCGATAGCTCAGCCCGGCAGAGCGTCTGGCTTTTAACCAGATGGTCGGGGGTTCAAA
TCCCTCTCGGCCCGtcc
Downstream region at tRNA end position
tgtatgcgtt
Secondary structure (Cloverleaf model)
>At1691	Lys	TTT
                   t      Gtcc tgtatgcgtt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T          T A
                    T     C T C C C     A
      C G A        A      | + | | |     A
    C       C T C G       G G G G G     C
    C       | | | |                 T T
    G       G A G C
      G C A        G     TGGTC
                    T - A
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGATAGCTCAGCCCGGCAGAGCGTCTGGCTTTTAACCAGATGGTCGGGGGTTCAAA
TCCCTCTCGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK