The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1706
Genome IDCR936257
Search identical group
Phylum/ClassEuryarchaeota
SpeciesNatronomonas pharaonis DSM 2160 Gabara [CR936257]
Start position on genome 1224
End posion on genome 1153
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gacgaactgc
tRNA gene sequence
GGGCGCGTGGTCTAGTGGCTATGACGTGGCCCTTACAAGGCCAAGAAGATGGTTCAATTC
CATCCGCGCCCActc
Downstream region at tRNA end position
tgttccgaca
Secondary structure (Cloverleaf model)
>At1706	Val	TAC
                   c      Actc tgttccgaca
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C
                     C - G
                     G - C          T T
                    T     C T A C C     A
      T G A        G      | | | | |     A
    G       T C T G       G A T G G     C
    G         | | |                 T T
    C       T G A C
      T A          G     AGAA
                    T - A
                    G - C
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCGCGTGGTCTAGTGGCTATGACGTGGCCCTTACAAGGCCAAGAAGATGGTTCAATTC
CATCCGCGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK