The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1712
Genome IDCR936257
Search identical group
Phylum/ClassEuryarchaeota
SpeciesNatronomonas pharaonis DSM 2160 Gabara [CR936257]
Start position on genome 437996
End posion on genome 437924
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
agtgcaggca
tRNA gene sequence
GCCCGGGTGGTGTAGTGGCCCATCATACGACCCTGTCACGGTCGTGACGCGGGTTCAAAT
CCCGCCTCGGGCGttt
Downstream region at tRNA end position
ctctgatacc
Secondary structure (Cloverleaf model)
>At1712	Asp	GTC
                   a      Gttt ctctgatacc
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G + T
                     G - C          T A
                    T     C G C C C     A
      T G A        G      | | | | |     A
    G       T G T G       G C G G G     C
    G         | | +                 T T
    C       T C A T
      C C A        A     TGAC
                    C - G
                    G - C
                    A - T
                    C - G
                    C - G
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCGGGTGGTGTAGTGGCCCATCATACGACCCTGTCACGGTCGTGACGCGGGTTCAAAT
CCCGCCTCGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK