The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1715
Genome IDCR936257
Search identical group
Phylum/ClassEuryarchaeota
SpeciesNatronomonas pharaonis DSM 2160 Gabara [CR936257]
Start position on genome 725856
End posion on genome 725784
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
cttcgggcgc
tRNA gene sequence
AGTCCCGTGGTGTAGTGGCCAATCATATGGGCCTTTGGAGCCCATGACGCTGGTTCGAAT
CCAGCCGGGACTActt
Downstream region at tRNA end position
ctctacggca
Secondary structure (Cloverleaf model)
>At1715	Gln	TTG
                   c      Actt ctctacggca
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G A C C     A
      T G A        G      | | | | |     G
    G       T G T G       G C T G G     C
    G         | | +                 T T
    C       T C A T
      C A A        A     TGAC
                    T - A
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGTCCCGTGGTGTAGTGGCCAATCATATGGGCCTTTGGAGCCCATGACGCTGGTTCGAAT
CCAGCCGGGACTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK