The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1738
Genome IDAE017261
Search identical group
Phylum/ClassUnclassified
SpeciesPicrophilus oshimae DSM 9789 DSM 9790 [AE017261]
Start position on genome 563505
End posion on genome 563577
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
aaagtaataa
tRNA gene sequence
AGCTCCGTGGTGTAGTGGACAAGCATTTCGGACTTTGGATCCGACGACGGCAGTTCGAAT
CTGCCCGGAGCTAtat
Downstream region at tRNA end position
gattagaata
Secondary structure (Cloverleaf model)
>At1738	Gln	TTG
                   a      Atat gattagaata
                     A - T
                     G - C
                     C - G
                     T - A
                     C - G
                     C - G
                     G - C          T A
                    T     C C G T C     A
      T G A        G      | | | | |     G
    G       T G T G       G G C A G     C
    G       + | | +                 T T
    A       G C A T
      C A A        T     CGAC
                    T - A
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCTCCGTGGTGTAGTGGACAAGCATTTCGGACTTTGGATCCGACGACGGCAGTTCGAAT
CTGCCCGGAGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK