The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1769
Genome IDAE017261
Search identical group
Phylum/ClassUnclassified
SpeciesPicrophilus oshimae DSM 9789 DSM 9790 [AE017261]
Start position on genome 909582
End posion on genome 909500
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
cagaattgat
tRNA gene sequence
GCTGGGATAGCCTAGCCTGGTAGGGCGCAGGTCTGGAAAACCTGTGCTGAAATAGCTCGG
GAGTTCAAATCTCCCTCCCAGCGcat
Downstream region at tRNA end position
ttgcagttat
Secondary structure (Cloverleaf model)
>At1769	Ser	GGA
                   t      Gcat ttgcagttat
                     G - C
                     C - G
                     T - A
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C C C T C     A
      C G A        A      | | | | |     A
    C       T C C G       G G G A G     C
    T       + | | |                 T T
    G       G G G C
      G T A        G     TGCTGAAATAGCTC
                    C - G
                    A - T
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCTGGGATAGCCTAGCCTGGTAGGGCGCAGGTCTGGAAAACCTGTGCTGAAATAGCTCGG
GAGTTCAAATCTCCCTCCCAGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK