The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1770
Genome IDAE017261
Search identical group
Phylum/ClassUnclassified
SpeciesPicrophilus oshimae DSM 9789 DSM 9790 [AE017261]
Start position on genome 911234
End posion on genome 911148
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
atgcattgat
tRNA gene sequence
GCTGGGATAGCCTAGCCCGGTAAGGCGGTAGACCCGAAATCTACTGCTCTCTGTAGCTCG
GGAGTTCAAATCTCCCTCCCAGCGCCA
Downstream region at tRNA end position
taagatgcat
Secondary structure (Cloverleaf model)
>At1770	Ser	CGA
                   t      GCCA taagatgcat
                     G - C
                     C - G
                     T - A
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C C C T C     A
      C G A        A      | | | | |     A
    C       T C C G       G G G A G     C
    C       | | | |                 T T
    G       A G G C
      G T A        G     TGCTCTCTGTAGCTC
                    G - C
                    T - A
                    A - T
                    G - C
                    A - T
                  C       A
                  C       A
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCTGGGATAGCCTAGCCCGGTAAGGCGGTAGACCCGAAATCTACTGCTCTCTGTAGCTCG
GGAGTTCAAATCTCCCTCCCAGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK