The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1783
Genome IDAL096836
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus abyssi [AL096836]
Start position on genome 416131
End posion on genome 416208
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
ctctaattgc
tRNA gene sequence
GCCCGGGTGGTGTAGCCCGGCCTATCATGCGGGACTGTCACTCCCGCGACCCGGGTTCAA
ATCCCGGCCCGGGCGCCA
Downstream region at tRNA end position
cttctaaata
Secondary structure (Cloverleaf model)
>At1783	Asp	GTC
                   c      GCCA cttctaaata
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        G      | | | | |     A
  C         T G T G       C C G G G     C
  G           | | +                 T T
  G         T C A T
    C C T A        G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCGGGTGGTGTAGCCCGGCCTATCATGCGGGACTGTCACTCCCGCGACCCGGGTTCAA
ATCCCGGCCCGGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK