The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1792
Genome IDAL096836
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus abyssi [AL096836]
Start position on genome 638589
End posion on genome 638675
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
tatagtgggt
tRNA gene sequence
GCCGGGGTAGCCTAGCCAGGGAAGGCGCGGGCCTGGAGAGCCCGTGGGCGTTCGCCCACC
GGGGTTCAAATCCCCGCCCCGGCGCCA
Downstream region at tRNA end position
aaatcattct
Secondary structure (Cloverleaf model)
>At1792	Ser	GGA
                   t      GCCA aaatcattct
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     G C C C C     A
      C G A        A      | | | | |     A
    C       T C C G       C G G G G     C
    A       | | | |                 T T
    G       A G G C
      G G A        G     TGGGCGTTCGCCCAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTAGCCTAGCCAGGGAAGGCGCGGGCCTGGAGAGCCCGTGGGCGTTCGCCCACC
GGGGTTCAAATCCCCGCCCCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK