The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1803
Genome IDAL096836
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus abyssi [AL096836]
Start position on genome 1522145
End posion on genome 1522220
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
ctttgggagt
tRNA gene sequence
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTTTGGATCCCGCGACCCGGGTTCGAAT
CCCGGCGGGGCTACCA
Downstream region at tRNA end position
taaaaccctc
Secondary structure (Cloverleaf model)
>At1803	Gln	TTG
                   t      ACCA taaaaccctc
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        G      | | | | |     G
    G       T G T G       C C G G G     C
    G       + | | +                 T T
    C       G C A T
      C A A        G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTTTGGATCCCGCGACCCGGGTTCGAAT
CCCGGCGGGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK