The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1823
Genome IDAL096836
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus abyssi [AL096836]
Start position on genome 1685759
End posion on genome 1685683
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tctcccgagt
tRNA gene sequence
GGGCCCGTAGCCTAGCAGGATAGGGCGCCGGCCTTCTAAGCCGGAGGTCGCGGGTTCGAA
TCCCGCCGGGCCCGCCA
Downstream region at tRNA end position
cttacgattc
Secondary structure (Cloverleaf model)
>At1823	Arg	TCT
                   t      GCCA cttacgattc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C C C     A
      C G A        A      | | | | |     G
    A       T C C G       G C G G G     C
    G       + | | |                 T T
    G       G G G C
      A T A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCCTAGCAGGATAGGGCGCCGGCCTTCTAAGCCGGAGGTCGCGGGTTCGAA
TCCCGCCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK