The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1827
Genome IDAE009950
Search identical group
Phylum/ClassEuryarchaeota
SpeciesPyrococcus furiosus DSM 3638 [AE009950]
Start position on genome 398462
End posion on genome 398537
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gattgggcat
tRNA gene sequence
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTTTGGATCCCGCGACCCGGGTTCGAAT
CCCGGCGGGGCTACCA
Downstream region at tRNA end position
tcgttttctt
Secondary structure (Cloverleaf model)
>At1827	Gln	TTG
                   t      ACCA tcgttttctt
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        G      | | | | |     G
    G       T G T G       C C G G G     C
    G       + | | +                 T T
    C       G C A T
      C A A        G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTTTGGATCCCGCGACCCGGGTTCGAAT
CCCGGCGGGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK